ID   COSKT1     preliminary; circular DNA; SYN; 5200 BP.
XX
AC   ATCC37606;
XX
DT   01-JUL-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli cosmid vector cosKT1 - incomplete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pUC18N from pUC18 & linker
RC   pUC19N from pUC19 & linker
RC   EMBL4N from EMBL4 & linker
RC   cosKT1 from pcos4EMBL & linker & pUC18
RA   Tartof K.D., Hobbs C.A.;
RT   "New cloning vectors and techniques for easy and rapid restriction
RT   mapping";
RL   Gene 67:169-182(1988).
XX
RN   [2]
RC   16-5, 16-7, 16-13, 16-16a, 16-19 from EMBL4 & Drosophila white locus
RC   a47 from pcos4EMBL & Drosophila white locus
RA   Pirrotta V., Hadfield C., Pretorius G.H.J.;
RT   "Microdissection and cloning of the white locus and the 3B1-3C2
RT   region of the Drosophila X chromosome";
RL   EMBO J. 2:927-934(1983).
XX
RN   [3]
RC   pcos4EMBL from lambda, cos
RA   Reedy X., Lehrach H.;
RT   ;
RL   Unpublished (1983).
XX
CC   cos4/pcos4EMBL was digested with BamHI+AvaI, the 1.1 kb fragment
CC   removed and the remaining ends filled in.
CC   Synthetic NotI linkers were inserted into
CC   the EcoRI & HindIII sites.  The small fragment between EcoRI & HindIII
CC   was replaced with the pUC18 polylinker.
CC   Cosmid clones contain either 3.2 or 2.7 kb of the original vector
CC   depending on which cos site was used in packaging.  This does not
CC   affect the use of NotI sites in restriction mapping of the clone.
CC   Cosmid vector with a cloning capacity of 35-45 kb, 3 cos sites, and
CC   NotI sites flanking the polylinker sites for ease of restriction
CC   mapping.
CC   Restriction digests of the clone give the following sizes (kb):
CC   EcoRI--5.3; BamHI--5.3; PstI--4.30, 0.8. (ATCC staff)
CC   PATENT PENDING.
CC   Medium is 1227 LB plus ampicillin.
CC   NM (cosKT1)
CC   CM (no)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (cosmid)
CC   SP (ATCC)
CC   HO (E.coli DH5alpha)(E.coli)
CC   CP ()
CC   FN (cloning 35000-45000)
CC   SE ()
CC   PA ()
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pBR322 PvuII 4361bp 2069..2069
FT                   2. lambda ?-PvuII 1000bp ?..leftend..212, 2 cos
FT                   3. lambda ?-PvuII 1000bp ?..leftend..212, 2 cos
FT                   -> pcos4EMBL 6300bp [2 tandem cos with PvuII between]
FT                   1. pcos4EMBL remove BamHI-AvaI 1050bp 376..-..1426,
FT                   \ 2 lambda cos/5200bp
FT                   Klenow:Klenow
FT                   -> cosmid 5200bp
FT                   1. cosmid EcoRI 5200bp, pBR322 4360..4360
FT                   2. EcoRI-NotI-EcoRI linker 30bp
FT                   \ aattgcggccgcatacaggctgtcagactg
FT                   -> cosmid2 5200bp
FT                   1. cosmid2 HindIII 4189bp, pBR322 30..30
FT                   2. HindIII-NotI-HindIII linker 30bp
FT                   \ agctagcggccgctaaccagttcgtcgcaa
FT                   -> cosmid3 5200bp
FT                   1. cosmid3 remove EcoRI-HindIII 31bp, MCS/5200bp
FT                   \ pBR322 4360..4361..30
FT                   2. pUC18 HindIII-EcoRI 51bp 400..451, MCS
FT                   -> cosKT1 5200bp"
FT   misc_binding    0..0
FT                   /note="MCS NotI-EcoRI-SacI-KpnI-SmaI-XmaI-BamHI-
FT                   XbaI-HincII-AccI-SalI-PstI-SphI-HindIII-NotI"
FT   misc_binding    0..0
FT                   /note="SIT unique PvuII-HpaI-EcoRI-SacI-KpnI-SmaI-
FT                   XmaI-BamHI-XbaI-HincII-AccI-SalI-PstI-SphI-HindIII"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   CDS             0..0
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
XX
SQ   Sequence 1 BP; 0 A; 0 C; 0 G; 0 T; 1 other;
     n
//