ID   LORIST6    preliminary; circular DNA; SYN; 5156 BP.
XX
AC   IG9600;
XX
DT   01-JUL-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   E. coli cosmid vector Lorist6 - incomplete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   LoristE6 from LoristB & oligo, trpA terminator
RC   Lorist2 from LoristE6 & oligo, rrnC terminator
RA   Gibson T.J., Coulson A.R., Sulston J.E., Little P.F.;
RT   "Lorist2, a cosmid with transcriptional terminators insulating
RT   vector genes from interference by promoters within the insert:
RT   effect on DNA yield and cloned insert frequency";
RL   Gene 53:275-281(1987).
XX
RN   [2]
RC   Lorist3 from Lorist2 & oligo, tet promoter
RC   Lorist4 from Lorist3 & linker
RC   Lorist6 from Lorist4 & oligo, trpA terminator
RA   Gibson T.J., Rosenthal A., Waterson R.H.;
RT   "Lorist6, a cosmid vector with BamHI, NotI, ScaI and HindIII cloning
RT   sites and altered neomycin phosphotransferase gene expression";
RL   Gene 53:283-286(1987).
XX
CC   Accepts blunt-ended DNA.
CC   Cosmid vector for genomic library construction.  Insert-end-specific
CC   probes may be generated from T7 and SP6 promoters.
CC   Restriction digests of the clone give the following sizes (kb):
CC   BamHI--5.7; HindIII--5.7. (ATCC staff)
CC   Medium is 1236 LB plus kanamycin.
CC   NM (Lorist6)
CC   CM (no)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (cosmid)
CC   SP (ATCC)
CC   HO (E.coli 1046)(E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA (Lorist2)
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. Lorist2 remove NheI-BclI 327bp
FT                   \ 3125..3452, LoristB 4104..4431/5237bp
FT                   \ LoristB BclI = 4431
FT                   \ LoristB NheI = 1153 4104
FT                   2. oligo NheI-tet promoter-EcoRI-BclI 54bp
FT                   \ ctagcgaattctcatgtttgacagcttatcatcgatatgctttaatgcgg
FT                   \ tagt, tet promoter/no HindIII
FT                   -> Lorist3 5291bp
FT                   1. Lorist3 BamHI 5291bp 1..1
FT                   \ LoristB BamHI = 902
FT                   2. linker NotI-ScaI 19bp gatcgcggccgcagtactg
FT                   -> Lorist4 5310bp
FT                   1. Lorist4 remove AsuII-SauI/MstII 194bp 4292..4486,
FT                   \ LoristB 5271..5465/5116bp
FT                   2. oligo AsuII-trpA-SalI-SauI/MstII 41bp
FT                   \ tcaggaaaaaaaagcccgctcattaggcgggctgtcgacat, trpA term
FT                   -> Lorist6 5156bp"
FT   promoter        0..0
FT                   /note="PRO bacteriophage T7"
FT   misc_binding    0..0
FT                   /note="MCS unique HindIII-NotI-ScaI-BamHI"
FT   promoter        0..0
FT                   /note="PRO bacteriophage Sp6"
FT   terminator      0..0
FT                   /note="TER E. coli rrnC"
FT   rep_origin      0..0
FT                   /note="ORI bacteriophage lambda"
FT   CDS             0..0
FT                   /note="GEN lambda P gene"
FT   CDS             0..0
FT                   /note="GEN lambda O gene"
FT   CDS             0..0
FT                   /note="GEN lambda cII gene"
FT   CDS             0..0
FT                   /note="GEN lambda cro gene"
FT   promoter        0..0
FT                   /note="PRO lambda pR"
FT   promoter        0..0
FT                   /note="PRO E. coli tet gene"
FT   CDS             0..0
FT                   /note="ANT E. coli neomycin phosphotransferase gene
FT                   (NPT); neomycin resistance gene (neo)"
FT   terminator      0..0
FT                   /note="TER E. coli trpA"
FT   misc_binding    0..0
FT                   /note="SIT lambda cos"
FT   terminator      0..0
FT                   /note="TER E. coli trpA"
XX
SQ   Sequence 1 BP; 0 A; 0 C; 0 G; 0 T; 1 other;
     n
//